Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PRKCI cDNA Clone in Mammalian Expression Vector

This is a Protein Kinase C, iota plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2300 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3386043
Supplier Product No.: sc118455
$541.53
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PRKCI cDNA Clone in Mammalian Expression Vector (ABIN3386043)

Gene

PKC iota (PRKCI) (Protein Kinase C, iota (PRKCI))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc118455

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PRKCI is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2300 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Nanos-Webb, Bui, Karakas, Zhang, Carey, Mills, Hunt, Keyomarsi: "PKCiota promotes ovarian tumor progression through deregulation of cyclin E." in: Oncogene, Vol. 35, Issue 19, pp. 2428-40, (2016) (PubMed).

    Forteza, Wald, Mashukova, Kozhekbaeva, Salas: "Par-complex aPKC and Par3 cross-talk with innate immunity NF-κB pathway in epithelial cells." in: Biology open, Vol. 2, Issue 11, pp. 1264-9, (2013) (PubMed).

    Wald, Oriolo, Mashukova, Fregien, Langshaw, Salas: "Atypical protein kinase C (iota) activates ezrin in the apical domain of intestinal epithelial cells." in: Journal of cell science, Vol. 121, Issue Pt 5, pp. 644-54, (2008) (PubMed).

  • Target

    PKC iota (PRKCI) (Protein Kinase C, iota (PRKCI))

    Alternative Name

    PRKCI

    Background

    This gene encodes a member of the protein kinase C (PKC) family of serine/threonine protein kinases. The PKC family comprises at least eight members, which are differentially expressed and are involved in a wide variety of cellular processes. This protein kinase is calcium-independent and phospholipid-dependent. It is not activated by phorbolesters or diacylglycerol. This kinase can be recruited to vesicle tubular clusters (VTCs) by direct interaction with the small GTPase RAB2, where this kinase phosphorylates glyceraldehyde-3-phosphate dehydrogenase (GAPD/GAPDH) and plays a role in microtubule dynamics in the early secretory pathway. This kinase is found to be necessary for BCL-ABL-mediated resistance to drug-induced apoptosis and therefore protects leukemia cells against drug-induced apoptosis. There is a single exon pseudogene mapped on chromosome X. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_002740, NP_002731
You are here: