Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PRPF8 cDNA Clone in Mammalian Expression Vector

This is a PRP8 Pre-mRNA Processing Factor 8 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 7140 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3386068
Supplier Product No.: sc116070
$1,990.89
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PRPF8 cDNA Clone in Mammalian Expression Vector (ABIN3386068)

Gene

PRPF8 (PRP8 Pre-mRNA Processing Factor 8 (PRPF8))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc116070

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PRPF8 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    7140 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Wang, Nguyen, Masoodi, Singh, Jing, OMalley, Dar, Dhir, Wang: "Splicing Factor Prp8 Interacts With NES(AR) and Regulates Androgen Receptor in Prostate Cancer Cells." in: Molecular endocrinology (Baltimore, Md.), Vol. 29, Issue 12, pp. 1731-42, (2015) (PubMed).

    Tresini, Warmerdam, Kolovos, Snijder, Vrouwe, Demmers, van IJcken, Grosveld, Medema, Hoeijmakers, Mullenders, Vermeulen, Marteijn: "The core spliceosome as target and effector of non-canonical ATM signalling." in: Nature, Vol. 523, Issue 7558, pp. 53-8, (2015) (PubMed).

    Liu, Kuo, Lin, Huang, Huang, Liu, Arnold, Chen, Wang, Cameron, Shih: "Cytoplasmic viral RNA-dependent RNA polymerase disrupts the intracellular splicing machinery by entering the nucleus and interfering with Prp8." in: PLoS pathogens, Vol. 10, Issue 6, pp. e1004199, (2014) (PubMed).

    Mulvihill, Benjamin, Ji, Le Scolan, Louie, Shieh, Green, Narasimhalu, Morris, Luo, Nomura: "Metabolic profiling reveals PAFAH1B3 as a critical driver of breast cancer pathogenicity." in: Chemistry & biology, Vol. 21, Issue 7, pp. 831-40, (2014) (PubMed).

  • Target

    PRPF8 (PRP8 Pre-mRNA Processing Factor 8 (PRPF8))

    Alternative Name

    PRPF8

    Background

    Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_006445, NP_006436
You are here: