Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PSEN1 cDNA Clone in Mammalian Expression Vector

This is a Presenilin 1 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2700 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3386089
Supplier Product No.: sc125532
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PSEN1 cDNA Clone in Mammalian Expression Vector (ABIN3386089)

Gene

Presenilin 1 (PSEN1)

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc125532

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PSEN1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2700 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Lombardo, Filipović, Molyneux, Periyasamy, Giamas, Hu, Trivedi, Wang, Yagüe, Michel, Coombes: "Nicastrin regulates breast cancer stem cell properties and tumor growth in vitro and in vivo." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 109, Issue 41, pp. 16558-63, (2012) (PubMed).

    Dror, Kalynyak, Bychkivska, Frey, Tee, Jeffrey, Nguyen, Luciani, Johnson: "Glucose and endoplasmic reticulum calcium channels regulate HIF-1beta via presenilin in pancreatic beta-cells." in: The Journal of biological chemistry, Vol. 283, Issue 15, pp. 9909-16, (2008) (PubMed).

  • Target

    Presenilin 1 (PSEN1)

    Alternative Name

    PSEN1

    Background

    Alzheimer's disease (AD) patients with an inherited form of the disease carry mutations in the presenilin proteins (PSEN1, PSEN2) or in the amyloid precursor protein (APP). These disease-linked mutations result in increased production of the longer form of amyloid-beta (main component of amyloid deposits found in AD brains). Presenilins are postulated to regulate APP processing through their effects on gamma-secretase, an enzyme that cleaves APP. Also, it is thought that the presenilins are involved in the cleavage of the Notch receptor, such that they either directly regulate gamma-secretase activity or themselves are protease enzymes. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene, the full-length nature of only some have been determined. [provided by RefSeq, Aug 2008].Transcript Variant: This variant (1) encodes the longer isoform (I-467).

    NCBI Accession

    NM_000021, NP_000012
You are here: