Human PSMD9 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human PSMD9 cDNA Clone in Mammalian Expression Vector (ABIN3386129)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc118384
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human PSMD9 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1140 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "A novel role for the proteasomal chaperone PSMD9 and hnRNPA1 in enhancing IκBα degradation and NF-κB activation - functional relevance of predicted PDZ domain-motif interaction." in: The FEBS journal, Vol. 281, Issue 11, pp. 2688-709, (2014) (PubMed).
: "Discovery of novel interacting partners of PSMD9, a proteasomal chaperone: Role of an Atypical and versatile PDZ-domain motif interaction and identification of putative functional modules." in: FEBS open bio, Vol. 4, pp. 571-83, (2014) (PubMed).
-
-
- PSMD9 (Proteasome (Prosome, Macropain) 26S Subunit, Non-ATPase, 9 (PSMD9))
-
Alternative Name
- PSMD9
-
Background
- The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits, 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2012].Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1).
-
NCBI Accession
- NM_002813, NP_002804
Target
-