Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PTBP1 cDNA Clone in Mammalian Expression Vector

This is a Polypyrimidine Tract Binding Protein 1 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 3070 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3386139
Supplier Product No.: sc106769
$507.87
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PTBP1 cDNA Clone in Mammalian Expression Vector (ABIN3386139)

Gene

PTBP1 (Polypyrimidine Tract Binding Protein 1 (PTBP1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc106769

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PTBP1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3070 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    PTBP1 (Polypyrimidine Tract Binding Protein 1 (PTBP1))

    Alternative Name

    PTBP1

    Background

    This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA-binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has four repeats of quasi-RNA recognition motif (RRM) domains that bind RNAs. This protein binds to the intronic polypyrimidine tracts that requires pre-mRNA splicing and acts via the protein degradation ubiquitin-proteasome pathway. It may also promote the binding of U2 snRNP to pre-mRNAs. This protein is localized in the nucleoplasm and it is also detected in the perinucleolar structure. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2) uses an alternative splice site resulting in it lacking 21 nt in the coding region compared to variant 1. Thus isoform b is 7 aa shorter than isoform a, but it maintains the same reading frame.

    NCBI Accession

    NM_031990, NP_114367
You are here: