Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human SLC22A2 cDNA Clone in Mammalian Expression Vector

This is a Solute Carrier Family 22 (Organic Cation Transporter), Member 2 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2400 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3386748
Supplier Product No.: sc126370
$512.82
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human SLC22A2 cDNA Clone in Mammalian Expression Vector (ABIN3386748)

Gene

SLC22A2 (Solute Carrier Family 22 (Organic Cation Transporter), Member 2 (SLC22A2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc126370

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SLC22A2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2400 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Wang, Sun, Li, Tu, Jiang: "Involvement of organic cation transporter 2 inhibition in potential mechanisms of antidepressant action." in: Progress in neuro-psychopharmacology & biological psychiatry, Vol. 53, pp. 90-8, (2014) (PubMed).

    Sprowl, Ciarimboli, Lancaster, Giovinazzo, Gibson, Du, Janke, Cavaletti, Shields, Sparreboom: "Oxaliplatin-induced neurotoxicity is dependent on the organic cation transporter OCT2." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 110, Issue 27, pp. 11199-204, (2013) (PubMed).

    Filipski, Loos, Verweij, Sparreboom: "Interaction of Cisplatin with the human organic cation transporter 2." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 14, Issue 12, pp. 3875-80, (2008) (PubMed).

  • Target

    SLC22A2 (Solute Carrier Family 22 (Organic Cation Transporter), Member 2 (SLC22A2))

    Alternative Name

    SLC22A2

    Background

    Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. It is found primarily in the kidney, where it may mediate the first step in cation reabsorption. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) is the shorter transcript but encodes the longer isoform (a).

    NCBI Accession

    NM_003058, NP_003049
You are here: