Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human SLC33A1 cDNA Clone in Mammalian Expression Vector

This is a Solute Carrier Family 33 Member 1 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2640 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3386779
Supplier Product No.: sc117182
$506.88
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human SLC33A1 cDNA Clone in Mammalian Expression Vector (ABIN3386779)

Gene

SLC33A1 (Solute Carrier Family 33 Member 1 (SLC33A1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc117182

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SLC33A1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2640 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Peng, Li, Clarkson, Pehar, Lao, Hillmer, Barnhart, Christian, Mitchell, Bendlin, Sandor, Puglielli: "Deficient import of acetyl-CoA into the ER lumen causes neurodegeneration and propensity to infections, inflammation, and cancer." in: The Journal of neuroscience : the official journal of the Society for Neuroscience, Vol. 34, Issue 20, pp. 6772-89, (2014) (PubMed).

    Pehar, Jonas, Hare, Puglielli: "SLC33A1/AT-1 protein regulates the induction of autophagy downstream of IRE1/XBP1 pathway." in: The Journal of biological chemistry, Vol. 287, Issue 35, pp. 29921-30, (2012) (PubMed).

    Jonas, Pehar, Puglielli: "AT-1 is the ER membrane acetyl-CoA transporter and is essential for cell viability." in: Journal of cell science, Vol. 123, Issue Pt 19, pp. 3378-88, (2010) (PubMed).

  • Target

    SLC33A1 (Solute Carrier Family 33 Member 1 (SLC33A1))

    Alternative Name

    SLC33A1

    Background

    The protein encoded by this gene is required for the formation of O-acetylated (Ac) gangliosides. The encoded protein is predicted to contain 6 to 10 transmembrane domains, and a leucine zipper motif in transmembrane domain III. Defects in this gene have been reported to cause spastic paraplegia autosomal dominant type 42 (SPG42) in one Chinese family, but not in similar patients of European descent. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2010].Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein.

    NCBI Accession

    NM_004733, NP_004724
You are here: