Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human SNCA cDNA Clone in Mammalian Expression Vector

This is a Synuclein, alpha plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1330 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3386865
Supplier Product No.: sc119919
$148.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human SNCA cDNA Clone in Mammalian Expression Vector (ABIN3386865)

Gene

SNCA (Synuclein, alpha (SNCA))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119919

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SNCA is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1330 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Baksi, Tripathi, Singh: "Alpha-synuclein modulates retinal iron homeostasis by facilitating the uptake of transferrin-bound iron: Implications for visual manifestations of Parkinson's disease." in: Free radical biology & medicine, Vol. 97, pp. 292-306, (2016) (PubMed).

    Krishnan, Tsubery, Proschitsky, Asp, Lulu, Gilead, Gartner, Waltho, Davis, Hounslow, Kirschner, Inouye, Myszka, Wright, Solomon, Fisher: "A bacteriophage capsid protein provides a general amyloid interaction motif (GAIM) that binds and remodels misfolded protein assemblies." in: Journal of molecular biology, Vol. 426, Issue 13, pp. 2500-19, (2014) (PubMed).

    Wang, Wilfred, Madathil, Tang, Hu, Dimayuga, Stromberg, Huang, Saatman, Nelson: "miR-107 regulates granulin/progranulin with implications for traumatic brain injury and neurodegenerative disease." in: The American journal of pathology, Vol. 177, Issue 1, pp. 334-45, (2010) (PubMed).

  • Target

    SNCA (Synuclein, alpha (SNCA))

    Alternative Name

    SNCA

    Background

    Alpha-synuclein is a member of the synuclein family, which also includes beta- and gamma-synuclein. Synucleins are abundantly expressed in the brain and alpha- and beta-synuclein inhibit phospholipase D2 selectively. SNCA may serve to integrate presynaptic signaling and membrane trafficking. Defects in SNCA have been implicated in the pathogenesis of Parkinson disease. SNCA peptides are a major component of amyloid plaques in the brains of patients with Alzheimer's disease. Four alternatively spliced transcripts encoding two different isoforms have been identified for this gene. [provided by RefSeq, Mar 2009].Transcript Variant: This variant (1, also known as NACP140) is the longest transcript and encodes the longer isoform (NACP140). Variants 1, 2, and 3 all encode the same isoform.

    NCBI Accession

    NM_000345, NP_000336
You are here: