Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human SOD1 cDNA Clone in Mammalian Expression Vector

This is a Superoxide Dismutase 1, Soluble plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 940 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3386910
Supplier Product No.: sc111022
$148.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human SOD1 cDNA Clone in Mammalian Expression Vector (ABIN3386910)

Gene

SOD1 (Superoxide Dismutase 1, Soluble (SOD1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc111022

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SOD1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    940 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Kim, Grailhe: "Nanoluciferase signal brightness using furimazine substrates opens bioluminescence resonance energy transfer to widefield microscopy." in: Cytometry. Part A : the journal of the International Society for Analytical Cytology, Vol. 89, Issue 8, pp. 742-6, (2016) (PubMed).

    Sirangelo, Vella, Irace, Manco, Iannuzzi: "Glycation in Demetalated Superoxide Dismutase 1 Prevents Amyloid Aggregation and Produces Cytotoxic Ages Adducts." in: Frontiers in molecular biosciences, Vol. 3, pp. 55, (2016) (PubMed).

    Wang, Son, Chang, Sun, Hitron, Budhraja, Zhang, Ke, Chen, Luo, Shi: "NADPH oxidase activation is required in reactive oxygen species generation and cell transformation induced by hexavalent chromium." in: Toxicological sciences : an official journal of the Society of Toxicology, Vol. 123, Issue 2, pp. 399-410, (2011) (PubMed).

    Stockwin, Bumke, Yu, Webb, Collins, Hollingshead, Newton: "Proteomic analysis identifies oxidative stress induction by adaphostin." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 13, Issue 12, pp. 3667-81, (2007) (PubMed).

  • Target

    SOD1 (Superoxide Dismutase 1, Soluble (SOD1))

    Alternative Name

    SOD1

    Background

    The protein encoded by this gene binds copper and zinc ions and is one of two isozymes responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic protein, acting as a homodimer to convert naturally-occuring but harmful superoxide radicals to molecular oxygen and hydrogen peroxide. The other isozyme is a mitochondrial protein. Mutations in this gene have been implicated as causes of familial amyotrophic lateral sclerosis. Rare transcript variants have been reported for this gene. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_000454, NP_000445
You are here: