Human SOD1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human SOD1 cDNA Clone in Mammalian Expression Vector (ABIN3386910)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc111022
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human SOD1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 940 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Nanoluciferase signal brightness using furimazine substrates opens bioluminescence resonance energy transfer to widefield microscopy." in: Cytometry. Part A : the journal of the International Society for Analytical Cytology, Vol. 89, Issue 8, pp. 742-6, (2016) (PubMed).
: "Glycation in Demetalated Superoxide Dismutase 1 Prevents Amyloid Aggregation and Produces Cytotoxic Ages Adducts." in: Frontiers in molecular biosciences, Vol. 3, pp. 55, (2016) (PubMed).
: "NADPH oxidase activation is required in reactive oxygen species generation and cell transformation induced by hexavalent chromium." in: Toxicological sciences : an official journal of the Society of Toxicology, Vol. 123, Issue 2, pp. 399-410, (2011) (PubMed).
: "Proteomic analysis identifies oxidative stress induction by adaphostin." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 13, Issue 12, pp. 3667-81, (2007) (PubMed).
-
-
- SOD1 (Superoxide Dismutase 1, Soluble (SOD1))
-
Alternative Name
- SOD1
-
Background
- The protein encoded by this gene binds copper and zinc ions and is one of two isozymes responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic protein, acting as a homodimer to convert naturally-occuring but harmful superoxide radicals to molecular oxygen and hydrogen peroxide. The other isozyme is a mitochondrial protein. Mutations in this gene have been implicated as causes of familial amyotrophic lateral sclerosis. Rare transcript variants have been reported for this gene. [provided by RefSeq, Jul 2008].
-
NCBI Accession
- NM_000454, NP_000445
Target
-