Human STAT3 cDNA Clone in Mammalian Expression Vector
This is a Signal Transducer and Activator of Transcription 3 (Acute-Phase Response Factor) plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 3570 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(2 references)
Catalog No. ABIN3387015
Supplier Product No.: sc100105
$655.38
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human STAT3 cDNA Clone in Mammalian Expression Vector (ABIN3387015)
Gene
STAT3
(Signal Transducer and Activator of Transcription 3 (Acute-Phase Response Factor) (STAT3))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc100105
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human STAT3 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 3570 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Sorafenib inhibits STAT3 activation to enhance TRAIL-mediated apoptosis in human pancreatic cancer cells." in: Molecular cancer therapeutics, Vol. 9, Issue 3, pp. 742-50, (2010) (PubMed).
: "Sorafenib overcomes TRAIL resistance of hepatocellular carcinoma cells through the inhibition of STAT3." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 16, Issue 21, pp. 5189-99, (2010) (PubMed).
-
-
- STAT3 (Signal Transducer and Activator of Transcription 3 (Acute-Phase Response Factor) (STAT3))
-
Alternative Name
- STAT3
-
Background
- The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Mutations in this gene are associated with infantile-onset multisystem autoimmune disease and hyper-immunoglobulin E syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2015].Transcript Variant: This variant (3), also called STAT3B or STAT3beta, lacks a segment in the coding region resulting in an early termination codon, compared to variant 1. Variant 3 encodes isoform 3, which has a shorter and distinct C-terminus compared to isoform 1.
-
NCBI Accession
- NM_213662, NP_998827
Target
-
You are here:
