Human STIM1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human STIM1 cDNA Clone in Mammalian Expression Vector (ABIN3387023)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc118136
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human STIM1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 4000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Conformational Changes in the Orai1 C-Terminus Evoked by STIM1 Binding." in: PLoS ONE, Vol. 10, Issue 6, pp. e0128622, (2015) (PubMed).
: "Inside-out Ca(2+) signalling prompted by STIM1 conformational switch." in: Nature communications, Vol. 6, pp. 7826, (2015) (PubMed).
: "Proteomic mapping of ER-PM junctions identifies STIMATE as a regulator of Ca²⁺ influx." in: Nature cell biology, Vol. 17, Issue 10, pp. 1339-47, (2015) (PubMed).
: "The C- and N-terminal STIM1 binding sites on Orai1 are required for both trapping and gating CRAC channels." in: The Journal of physiology, Vol. 591, Issue 11, pp. 2833-50, (2013) (PubMed).
: "STIM1 couples to ORAI1 via an intramolecular transition into an extended conformation." in: The EMBO journal, Vol. 30, Issue 9, pp. 1678-89, (2011) (PubMed).
: "Local cytosolic Ca2+ elevations are required for stromal interaction molecule 1 (STIM1) de-oligomerization and termination of store-operated Ca2+ entry." in: The Journal of biological chemistry, Vol. 286, Issue 42, pp. 36448-59, (2011) (PubMed).
: "Human muscle economy myoblast differentiation and excitation-contraction coupling use the same molecular partners, STIM1 and STIM2." in: The Journal of biological chemistry, Vol. 285, Issue 29, pp. 22437-47, (2010) (PubMed).
: "Stromal interaction molecule (STIM) 1 and STIM2 calcium sensing regions exhibit distinct unfolding and oligomerization kinetics." in: The Journal of biological chemistry, Vol. 284, Issue 2, pp. 728-32, (2009) (PubMed).
: "STIM1- and Orai1-dependent store-operated calcium entry regulates human myoblast differentiation." in: The Journal of biological chemistry, Vol. 284, Issue 8, pp. 5370-80, (2009) (PubMed).
: "The molecular architecture of the arachidonate-regulated Ca2+-selective ARC channel is a pentameric assembly of Orai1 and Orai3 subunits." in: The Journal of physiology, Vol. 587, Issue Pt 17, pp. 4181-97, (2009) (PubMed).
: "TRPC channels function independently of STIM1 and Orai1." in: The Journal of physiology, Vol. 587, Issue Pt 10, pp. 2275-98, (2009) (PubMed).
: "Activation of TRPC1 by STIM1 in ER-PM microdomains involves release of the channel from its scaffold caveolin-1." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 106, Issue 47, pp. 20087-92, (2009) (PubMed).
: "Store-operated cyclic AMP signalling mediated by STIM1." in: Nature cell biology, Vol. 11, Issue 4, pp. 433-42, (2009) (PubMed).
: "Canonical transient receptor potential 5 channel in conjunction with Orai1 and STIM1 allows Sr2+ entry, optimal influx of Ca2+, and degranulation in a rat mast cell line." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 180, Issue 4, pp. 2233-9, (2008) (PubMed).
: "Relocalization of STIM1 for activation of store-operated Ca(2+) entry is determined by the depletion of subplasma membrane endoplasmic reticulum Ca(2+) store." in: The Journal of biological chemistry, Vol. 282, Issue 16, pp. 12176-85, (2007) (PubMed).
: "Ca2+ store depletion causes STIM1 to accumulate in ER regions closely associated with the plasma membrane." in: The Journal of cell biology, Vol. 174, Issue 6, pp. 803-13, (2006) (PubMed).
: "The elementary unit of store-operated Ca2+ entry: local activation of CRAC channels by STIM1 at ER-plasma membrane junctions." in: The Journal of cell biology, Vol. 174, Issue 6, pp. 815-25, (2006) (PubMed).
: "Large store-operated calcium selective currents due to co-expression of Orai1 or Orai2 with the intracellular calcium sensor, Stim1." in: The Journal of biological chemistry, Vol. 281, Issue 34, pp. 24979-90, (2006) (PubMed).
-
-
- STIM1 (Stromal Interaction Molecule 1 (STIM1))
-
Alternative Name
- STIM1
-
Background
- This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013].Transcript Variant: This variant (2, also known as STIM1S) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.
-
NCBI Accession
- NM_003156, NP_003147
Target
-