Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human STT3A cDNA Clone in Mammalian Expression Vector

This is a STT3, Subunit of The Oligosaccharyltransferase Complex, Homolog A plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2560 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3387048
Supplier Product No.: sc127610
$639.54
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human STT3A cDNA Clone in Mammalian Expression Vector (ABIN3387048)

Gene

STT3A (STT3, Subunit of The Oligosaccharyltransferase Complex, Homolog A (STT3A))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc127610

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human STT3A is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2560 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Shrimal, Ng, Losfeld, Gilmore, Freeze: "Mutations in STT3A and STT3B cause two congenital disorders of glycosylation." in: Human molecular genetics, Vol. 22, Issue 22, pp. 4638-45, (2013) (PubMed).

    Dumax-Vorzet, Roboti, High: "OST4 is a subunit of the mammalian oligosaccharyltransferase required for efficient N-glycosylation." in: Journal of cell science, Vol. 126, Issue Pt 12, pp. 2595-606, (2013) (PubMed).

    Roboti, High: "Keratinocyte-associated protein 2 is a bona fide subunit of the mammalian oligosaccharyltransferase." in: Journal of cell science, Vol. 125, Issue Pt 1, pp. 220-32, (2012) (PubMed).

    Cerutti, Latini, Nakabashi, Delcelo, Andrade, Amadei, Maciel, Hojaij, Hollis, Shoemaker, Riggins: "Diagnosis of suspicious thyroid nodules using four protein biomarkers." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 12, Issue 11 Pt 1, pp. 3311-8, (2006) (PubMed).

  • Target

    STT3A (STT3, Subunit of The Oligosaccharyltransferase Complex, Homolog A (STT3A))

    Alternative Name

    STT3A

    Background

    The protein encoded by this gene is a catalytic subunit of the N-oligosaccharyltransferase (OST) complex, which functions in the endoplasmic reticulum to transfer glycan chains to asparagine residues of target proteins. A separate complex containing a similar catalytic subunit with an overlapping function also exists. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015].Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same isoform (a).

    NCBI Accession

    NM_152713, NP_689926
You are here: