Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human TAP2 cDNA Clone in Mammalian Expression Vector

This is a Transporter 2, ATP-Binding Cassette, Sub-Family B (MDR/TAP) plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2380 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3387129
Supplier Product No.: sc109816
$638.55
Plus shipping costs $50.00
10 μg
Shipping to: United States
Will be delivered in 36 Business Days

Quick Overview for Human TAP2 cDNA Clone in Mammalian Expression Vector (ABIN3387129)

Gene

TAP2 (Transporter 2, ATP-Binding Cassette, Sub-Family B (MDR/TAP) (TAP2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc109816

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human TAP2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2380 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    TAP2 (Transporter 2, ATP-Binding Cassette, Sub-Family B (MDR/TAP) (TAP2))

    Alternative Name

    TAP2

    Background

    The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This gene is located 7 kb telomeric to gene family member ABCB2. The protein encoded by this gene is involved in antigen presentation. This protein forms a heterodimer with ABCB2 in order to transport peptides from the cytoplasm to the endoplasmic reticulum. Mutations in this gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Alternative splicing of this gene produces products which differ in peptide selectivity and level of restoration of surface expression of MHC class I molecules. [provided by RefSeq, Feb 2014].Transcript Variant: This variant (1, B allele) represents the longer transcript and encodes the longest isoform (1). An allele (variant 1, A allele) exists in which a single nt change creates an internal stop codon, leading to a protein that is 17 aa shorter at the C-terminus.

    NCBI Accession

    NM_000544, NP_000535
You are here: