Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human TBXAS1 cDNA Clone in Mammalian Expression Vector

This is a thromboxane A Synthase 1 (Platelet) plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1960 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3387157
Supplier Product No.: sc109823
$493.02
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human TBXAS1 cDNA Clone in Mammalian Expression Vector (ABIN3387157)

Gene

TBXAS1 (thromboxane A Synthase 1 (Platelet) (TBXAS1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc109823

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human TBXAS1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1960 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Meling, Zelasko, Kambalyal, Roy, Das: "Functional role of the conserved i-helix residue I346 in CYP5A1-Nanodiscs." in: Biophysical chemistry, Vol. 200-201, pp. 34-40, (2015) (PubMed).

    Das, Varma, Mularczyk, Meling: "Functional investigations of thromboxane synthase (CYP5A1) in lipid bilayers of nanodiscs." in: Chembiochem : a European journal of chemical biology, Vol. 15, Issue 6, pp. 892-9, (2014) (PubMed).

    Huang, Chu, Huang, Chen, Jiang, Zhang, Zeng: "18β-Glycyrrhetinic acid suppresses cell proliferation through inhibiting thromboxane synthase in non-small cell lung cancer." in: PLoS ONE, Vol. 9, Issue 4, pp. e93690, (2014) (PubMed).

  • Target

    TBXAS1 (thromboxane A Synthase 1 (Platelet) (TBXAS1))

    Alternative Name

    TBXAS1

    Background

    This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than functional similarity. This endoplasmic reticulum membrane protein catalyzes the conversion of prostglandin H2 to thromboxane A2, a potent vasoconstrictor and inducer of platelet aggregation. The enzyme plays a role in several pathophysiological processes including hemostasis, cardiovascular disease, and stroke. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008].Transcript Variant: This variant (1, also known as TXS-I) encodes isoform 1, which is also known as isoform TXS-I. Both variants 1 and 3 encode the same isoform.

    NCBI Accession

    NM_001061, NP_001052
You are here: