Human TP53 cDNA Clone in Mammalian Expression Vector
This is a Tumor Protein P53 plasmid from OriGene - 6 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2500 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(6 references)
Catalog No. ABIN3387396
Supplier Product No.: sc119832
$679.14
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human TP53 cDNA Clone in Mammalian Expression Vector (ABIN3387396)
Gene
p53 (TP53)
(Tumor Protein P53 (TP53))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc119832
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human TP53 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2500 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Molecular mechanism leading to SAHA-induced autophagy in tumor cells: evidence for a p53-dependent pathway." in: Cancer cell international, Vol. 16, Issue 1, pp. 68, (2016) (PubMed).
: "Cytosolic galectin-7 impairs p53 functions and induces chemoresistance in breast cancer cells." in: BMC cancer, Vol. 14, pp. 801, (2014) (PubMed).
: "SCO2 induces p53-mediated apoptosis by Thr845 phosphorylation of ASK-1 and dissociation of the ASK-1-Trx complex." in: Molecular and cellular biology, Vol. 33, Issue 7, pp. 1285-302, (2013) (PubMed).
: "miR-34a contributes to megakaryocytic differentiation of K562 cells independently of p53." in: Blood, Vol. 114, Issue 10, pp. 2181-92, (2009) (PubMed).
: "Interaction of heterogeneous nuclear ribonucleoprotein C1/C2 with a novel cis-regulatory element within p53 mRNA as a response to cytostatic drug treatment." in: Molecular pharmacology, Vol. 73, Issue 5, pp. 1558-67, (2008) (PubMed).
: "Macrophages produce TGF-beta-induced (beta-ig-h3) following ingestion of apoptotic cells and regulate MMP14 levels and collagen turnover in fibroblasts." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 180, Issue 7, pp. 5036-44, (2008) (PubMed).
-
: "Molecular mechanism leading to SAHA-induced autophagy in tumor cells: evidence for a p53-dependent pathway." in: Cancer cell international, Vol. 16, Issue 1, pp. 68, (2016) (PubMed).
-
- p53 (TP53) (Tumor Protein P53 (TP53))
-
Alternative Name
- TP53
-
Background
- This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons (PMIDs: 12032546, 20937277). [provided by RefSeq, Feb 2013].Transcript Variant: This variant (1) can initiate translation from two in-frame AUG start codons. The isoform represented in this variant (a, also known as p53alpha) results from translation initiation at the upstream start codon. Both variants 1 and 2 encode isoform a, which is the longest isoform.
-
NCBI Accession
- NM_000546, NP_000537
Target
-
You are here:
