Human TRIM34 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human TRIM34 cDNA Clone in Mammalian Expression Vector (ABIN3387450)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc124362
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human TRIM34 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2500 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human TRIM34 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human TRIM34 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)ORF PExp Mammalian Expression Vector pCMV6-Entry Kanamycin CMV Promoter Myc-DYKDDDDK Tag Transient
![Human TRIM34 cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human TRIM34 cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Human TRIM34 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human TRIM34 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)ORF PExp Mammalian Expression Vector pCMV6-Entry Kanamycin CMV Promoter Myc-DYKDDDDK Tag Transient
![Human TRIM34 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human TRIM34 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)ORF PExp Mammalian Expression Vector pCMV6-Entry Kanamycin CMV Promoter Myc-DYKDDDDK Tag Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- TRIM34 (Tripartite Motif Containing 34 (TRIM34))
-
Alternative Name
- TRIM34
-
Background
- The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, B-box type 1 and B-box type 2 domain, and a coiled-coil region. Expression of this gene is up-regulated by interferon. This gene is mapped to chromosome 11p15, where it resides within a TRIM gene cluster. Alternative splicing results in multiple transcript variants. A read-through transcript from the upstream TRIM6 gene has also been observed, which results in a fusion product from these neighboring family members. [provided by RefSeq, Oct 2010].Transcript Variant: This variant (1, also known as alpha) represents the longest transcript and encodes the longer isoform (1, also known as the middle form). Both variants 1 and 4 encode the same isoform.
-
NCBI Accession
- NM_021616, NP_067629
Target
-
