Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human VPS41 cDNA Clone in Mammalian Expression Vector

This is a Vacuolar Protein Sorting 41 Homolog plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 3410 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3387701
Supplier Product No.: sc111791
$775.17
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human VPS41 cDNA Clone in Mammalian Expression Vector (ABIN3387701)

Gene

VPS41 (Vacuolar Protein Sorting 41 Homolog (VPS41))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc111791

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human VPS41 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3410 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Zlatic, Tornieri, LHernault, Faundez: "Clathrin-dependent mechanisms modulate the subcellular distribution of class C Vps/HOPS tether subunits in polarized and nonpolarized cells." in: Molecular biology of the cell, Vol. 22, Issue 10, pp. 1699-715, (2011) (PubMed).

    Zhu, Salazar, Zlatic, Fiza, Doucette, Heilman, Levey, Faundez, Lhernault: "SPE-39 family proteins interact with the HOPS complex and function in lysosomal delivery." in: Molecular biology of the cell, Vol. 20, Issue 4, pp. 1223-40, (2009) (PubMed).

    Salazar, Zlatic, Craige, Peden, Pohl, Faundez: "Hermansky-Pudlak syndrome protein complexes associate with phosphatidylinositol 4-kinase type II alpha in neuronal and non-neuronal cells." in: The Journal of biological chemistry, Vol. 284, Issue 3, pp. 1790-802, (2009) (PubMed).

  • Target

    VPS41 (Vacuolar Protein Sorting 41 Homolog (VPS41))

    Alternative Name

    VPS41

    Background

    Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human ortholog of yeast Vps41 protein which is also conserved in Drosophila, tomato, and Arabidopsis. Expression studies in yeast and human indicate that this protein may be involved in the formation and fusion of transport vesicles from the Golgi. Several transcript variants encoding different isoforms have been described for this gene, however, the full-length nature of not all is known. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) encodes the full-length isoform (1).

    NCBI Accession

    NM_014396, NP_055211
You are here: