Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human XIAP cDNA Clone in Mammalian Expression Vector

This is a X-Linked Inhibitor of Apoptosis plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 3000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3387754
Supplier Product No.: sc119404
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human XIAP cDNA Clone in Mammalian Expression Vector (ABIN3387754)

Gene

XIAP (X-Linked Inhibitor of Apoptosis (XIAP))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119404

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human XIAP is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Shan, Ji, Barnard, Lipinski, You, Lee, Kamalden, Sun, MacLaren: "AAV-mediated gene transfer of human X-linked inhibitor of apoptosis protects against oxidative cell death in human RPE cells." in: Investigative ophthalmology & visual science, Vol. 52, Issue 13, pp. 9591-7, (2011) (PubMed).

    Ishdorj, Johnston, Gibson: "Inhibition of constitutive activation of STAT3 by curcurbitacin-I (JSI-124) sensitized human B-leukemia cells to apoptosis." in: Molecular cancer therapeutics, Vol. 9, Issue 12, pp. 3302-14, (2010) (PubMed).

  • Target

    XIAP (X-Linked Inhibitor of Apoptosis (XIAP))

    Alternative Name

    XIAP

    Background

    This gene encodes a protein that belongs to a family of apoptotic suppressor proteins. Members of this family share a conserved motif termed, baculovirus IAP repeat, which is necessary for their anti-apoptotic function. This protein functions through binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 and inhibits apoptosis induced by menadione, a potent inducer of free radicals, and interleukin 1-beta converting enzyme. This protein also inhibits at least two members of the caspase family of cell-death proteases, caspase-3 and caspase-7. Mutations in this gene are the cause of X-linked lymphoproliferative syndrome. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 2 and 11.[provided by RefSeq, Feb 2011].Transcript Variant: This variant (1) represents the longest transcript. Both variants 1 and 2 encode the same protein.

    NCBI Accession

    NM_001167, NP_001158
You are here: