Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human ABCC9 cDNA Clone in Mammalian Expression Vector

This is a ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 9 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 4900 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3388033
Supplier Product No.: sc316627
$1,968.12
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 2 to 4 Business Days

Quick Overview for Human ABCC9 cDNA Clone in Mammalian Expression Vector (ABIN3388033)

Gene

ABCC9 (ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 9 (ABCC9))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc316627

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human ABCC9 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4900 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    ABCC9 (ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 9 (ABCC9))

    Alternative Name

    ABCC9

    Background

    The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein is thought to form ATP-sensitive potassium channels in cardiac, skeletal, and vascular and non-vascular smooth muscle. Protein structure suggests a role as the drug-binding channel-modulating subunit of the extra-pancreatic ATP-sensitive potassium channels. Mutations in this gene are associated with cardiomyopathy dilated type 1O. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2011].Transcript Variant: This variant (SUR2A) uses an alternate 3' coding exon (exon 38A), compared to variant SUR2B, which uses exon 38B. The encoded isoform (SUR2A) has an alternate 38-amino acid C-terminus, but is the same length as isoform SUR2B. There are no full-length transcripts representing this variant in human, it is supported by partial transcript alignments, by full-length transcript alignments from the homologous mouse and rat genes, and by RT-PCR analysis in PMID:11054556.

    NCBI Accession

    NM_005691, NP_005682
You are here: