Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human ABCD4 cDNA Clone in Mammalian Expression Vector

This is a ATP-Binding Cassette, Sub-Family D (Ald), Member 4 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: not_set. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3388034
Supplier Product No.: sc304737
$600.93
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human ABCD4 cDNA Clone in Mammalian Expression Vector (ABIN3388034)

Gene

ABCD4 (ATP-Binding Cassette, Sub-Family D (Ald), Member 4 (ABCD4))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc304737

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human ABCD4 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    ABCD4 (ATP-Binding Cassette, Sub-Family D (Ald), Member 4 (ABCD4))

    Alternative Name

    ABCD4

    Background

    The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown. However, it is speculated that it may function as a heterodimer for another peroxisomal ABC transporter and, therefore, may modify the adrenoleukodystrophy phenotype. It may also play a role in the process of peroxisome biogenesis. Alternative splicing results in at least two different transcript variants, one which is protein-coding and one which is probably not protein-coding. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (4) contains a 171 bp insertion as a result of intron 18 retention. Inclusion of this intron results a premature stop codon and omission of the 14 amino-acid C-terminus present in transcript variant 1.

    NCBI Accession

    NM_020325, NP_064730
You are here: