Human ADAM17 cDNA Clone in Mammalian Expression Vector
This is a ADAM Metallopeptidase Domain 17 plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2100 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(1 reference)
Catalog No. ABIN3388099
Supplier Product No.: sc304964
$944.46
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 8 Business Days
Quick Overview for Human ADAM17 cDNA Clone in Mammalian Expression Vector (ABIN3388099)
Gene
ADAM17
(ADAM Metallopeptidase Domain 17 (ADAM17))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc304964
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ADAM17 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2100 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Angiotensin-(1-7)/Mas Signaling Inhibits Lipopolysaccharide-Induced ADAM17 Shedding Activity and Apoptosis in Alveolar Epithelial Cells." in: Pharmacology, Vol. 97, Issue 1-2, pp. 63-71, (2015) (PubMed).
-
: "Angiotensin-(1-7)/Mas Signaling Inhibits Lipopolysaccharide-Induced ADAM17 Shedding Activity and Apoptosis in Alveolar Epithelial Cells." in: Pharmacology, Vol. 97, Issue 1-2, pp. 63-71, (2015) (PubMed).
-
- ADAM17 (ADAM Metallopeptidase Domain 17 (ADAM17))
-
Alternative Name
- ADAM17
-
Background
- This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands. The encoded protein also plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease. [provided by RefSeq, Feb 2016].Transcript Variant: This variant (2) contains a 50 bps deletion in 3'- coding region, as compared to variant 1. As a result of a deletion and frame shift, isoform 2 encoded by this variant lacks a cytoplasmic domain containing 130 amino acids, as compared to isoform 1 encoded by variant 1.
-
NCBI Accession
- NM_021832, NP_068604
Target
-
You are here:
