Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human ADCY6 cDNA Clone in Mammalian Expression Vector

This is a Adenylate Cyclase 6 plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: not_set. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3388118
Supplier Product No.: sc126190
$1,510.74
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human ADCY6 cDNA Clone in Mammalian Expression Vector (ABIN3388118)

Gene

ADCY6 (Adenylate Cyclase 6 (ADCY6))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc126190

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human ADCY6 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Lefkimmiatis, Srikanthan, Maiellaro, Moyer, Curci, Hofer: "Store-operated cyclic AMP signalling mediated by STIM1." in: Nature cell biology, Vol. 11, Issue 4, pp. 433-42, (2009) (PubMed).

  • Target

    ADCY6 (Adenylate Cyclase 6 (ADCY6))

    Alternative Name

    ADCY6

    Background

    This gene encodes a member of the adenylyl cyclase family of proteins, which are required for the synthesis of cyclic AMP. All members of this family have an intracellular N-terminus, a tandem repeat of six transmembrane domains separated by a cytoplasmic loop, and a C-terminal cytoplasmic domain. The two cytoplasmic regions bind ATP and form the catalytic core of the protein. Adenylyl cyclases are important effectors of transmembrane signaling pathways and are regulated by the activity of G protein coupled receptor signaling. This protein belongs to a small subclass of adenylyl cyclase proteins that are functionally related and are inhibited by protein kinase A, calcium ions and nitric oxide. A mutation in this gene is associated with arthrogryposis multiplex congenita. [provided by RefSeq, May 2015].Transcript Variant: This variant (1) has an alternate 5' UTR and contains an in-frame fragment of 159 bp in the coding region, as compared to variant 2. Isoform a encoded by this variant thus has the same N- and C- termini as isoform b encoded by variant 2, but is 53 aa longer.

    NCBI Accession

    NM_015270, NP_056085
You are here: