Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human APOBEC3B cDNA Clone in Mammalian Expression Vector

This is a Apolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3B plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1400 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3388243
Supplier Product No.: sc303543
$679.14
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human APOBEC3B cDNA Clone in Mammalian Expression Vector (ABIN3388243)

Gene

APOBEC3B (Apolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3B (APOBEC3B))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc303543

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human APOBEC3B is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1400 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Siriwardena, Guruge, Bhagwat: "Characterization of the Catalytic Domain of Human APOBEC3B and the Critical Structural Role for a Conserved Methionine." in: Journal of molecular biology, Vol. 427, Issue 19, pp. 3042-55, (2015) (PubMed).

  • Target

    APOBEC3B (Apolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3B (APOBEC3B))

    Alternative Name

    APOBEC3B

    Background

    This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. A hybrid gene results from the deletion of approximately 29.5 kb of sequence between this gene, APOBEC3B, and the adjacent gene APOBEC3A. The breakpoints of the deletion are within the two genes, so the deletion allele is predicted to have the promoter and coding region of APOBEC3A, but the 3' UTR of APOBEC3B. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).

    NCBI Accession

    NM_004900, NP_004891
You are here: