Human AVP cDNA Clone in Mammalian Expression Vector
Quick Overview for Human AVP cDNA Clone in Mammalian Expression Vector (ABIN3388370)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc300079
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human AVP is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 600 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- Vasopressin (AVP) (Arginine Vasopressin (AVP))
-
Alternative Name
- AVP
-
Background
- This gene encodes a member of the vasopressin/oxytocin family and preproprotein that is proteolytically processed to generate multiple protein products. These products include the neuropeptide hormone arginine vasopressin, and two other peptides, neurophysin 2 and copeptin. Arginine vasopressin is a posterior pituitary hormone that is synthesized in the supraoptic nucleus and paraventricular nucleus of the hypothalamus. Along with its carrier protein, neurophysin 2, it is packaged into neurosecretory vesicles and transported axonally to the nerve endings in the neurohypophysis where it is either stored or secreted into the bloodstream. The precursor is thought to be activated while it is being transported along the axon to the posterior pituitary. Arginine vasopressin acts as a growth factor by enhancing pH regulation through acid-base transport systems. It has a direct antidiuretic action on the kidney, and also causes vasoconstriction of the peripheral vessels. This hormone can contract smooth muscle during parturition and lactation. It is also involved in cognition, tolerance, adaptation and complex sexual and maternal behaviour, as well as in the regulation of water excretion and cardiovascular functions. Mutations in this gene cause autosomal dominant neurohypophyseal diabetes insipidus (ADNDI). This gene is present in a gene cluster with the related gene oxytocin on chromosome 20. [provided by RefSeq, Nov 2015].
-
NCBI Accession
- NM_000490, NP_000481
Target
-