Human AVPR2 cDNA Clone in Mammalian Expression Vector
This is a Arginine Vasopressin Receptor 2 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: not_set. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
Catalog No. ABIN3388372
Supplier Product No.: sc326877
$326.70
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 21 to 22 Business Days
Quick Overview for Human AVPR2 cDNA Clone in Mammalian Expression Vector (ABIN3388372)
Gene
AVPR2
(Arginine Vasopressin Receptor 2 (AVPR2))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc326877
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human AVPR2 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- AVPR2 (Arginine Vasopressin Receptor 2 (AVPR2))
-
Alternative Name
- AVPR2
-
Background
- This gene encodes the vasopressin receptor, type 2, also known as the V2 receptor, which belongs to the seven-transmembrane-domain G protein-coupled receptor (GPCR) superfamily, and couples to Gs thus stimulating adenylate cyclase. The subfamily that includes the V2 receptor, the V1a and V1b vasopressin receptors, the oxytocin receptor, and isotocin and mesotocin receptors in non-mammals, is well conserved, though several members signal via other G proteins. All bind similar cyclic nonapeptide hormones. The V2 receptor is expressed in the kidney tubule, predominantly in the distal convoluted tubule and collecting ducts, where its primary property is to respond to the pituitary hormone arginine vasopressin (AVP) by stimulating mechanisms that concentrate the urine and maintain water homeostasis in the organism. When the function of this gene is lost, the disease Nephrogenic Diabetes Insipidus (NDI) results. The V2 receptor is also expressed outside the kidney although its tissue localization is uncertain. When these 'extrarenal receptors' are stimulated by infusion of a V2 selective agonist (dDAVP), a variety of clotting factors are released into the bloodstream. The physiologic importance of this property is not known - its absence does not appear to be detrimental in NDI patients. The gene expression has also been described in fetal lung tissue and lung cancer associated with alternative splicing. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2) has an additional segment in the CDS, as compared to variant 1. The resulting isoform (2) has shorter and different C-terminus, as compared to isoform 1.
-
NCBI Accession
- NM_001146151, NP_001139623
Target
-
You are here:
