Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human AXL cDNA Clone in Mammalian Expression Vector

This is a AXL Receptor tyrosine Kinase plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: not_set. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3388375
Supplier Product No.: sc112559
$810.81
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human AXL cDNA Clone in Mammalian Expression Vector (ABIN3388375)

Gene

AXL (AXL Receptor tyrosine Kinase (AXL))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc112559

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human AXL is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Iaboni, Russo, Fontanella, Roscigno, Fiore, Donnarumma, Esposito, Quintavalle, Giangrande, de Franciscis, Condorelli: "Aptamer-miRNA-212 Conjugate Sensitizes NSCLC Cells to TRAIL." in: Molecular therapy. Nucleic acids, Vol. 5, pp. e289, (2016) (PubMed).

    Salian-Mehta, Xu, Knox, Plummer, Slavov, Taylor, Bevers, Hodges, Crowley, Wierman: "Functional consequences of AXL sequence variants in hypogonadotropic hypogonadism." in: The Journal of clinical endocrinology and metabolism, Vol. 99, Issue 4, pp. 1452-60, (2014) (PubMed).

    Xu, Chan, Liu, Wong, Fan, Chen, Poon, Zender, Lowe, Hong, Luk: "AXL receptor kinase is a mediator of YAP-dependent oncogenic functions in hepatocellular carcinoma." in: Oncogene, Vol. 30, Issue 10, pp. 1229-40, (2011) (PubMed).

  • Target

    AXL (AXL Receptor tyrosine Kinase (AXL))

    Alternative Name

    AXL

    Background

    The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013].Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).

    NCBI Accession

    NM_021913, NP_068713
You are here: