Human BAX cDNA Clone in Mammalian Expression Vector
Quick Overview for Human BAX cDNA Clone in Mammalian Expression Vector (ABIN3388402)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc128293
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human BAX is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Sorafenib sensitizes (-)-gossypol-induced growth suppression in androgen-independent prostate cancer cells via Mcl-1 inhibition and Bak activation." in: Molecular cancer therapeutics, Vol. 11, Issue 2, pp. 416-26, (2012) (PubMed).
: "Activation of the JNK pathway promotes phosphorylation and degradation of BimEL--a novel mechanism of chemoresistance in T-cell acute lymphoblastic leukemia." in: Carcinogenesis, Vol. 29, Issue 3, pp. 544-51, (2008) (PubMed).
-
-
- BAX (BCL2-Associated X Protein (BAX))
-
Alternative Name
- BAX
-
Background
- The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein forms a heterodimer with BCL2, and functions as an apoptotic activator. This protein is reported to interact with, and increase the opening of, the mitochondrial voltage-dependent anion channel (VDAC), which leads to the loss in membrane potential and the release of cytochrome c. The expression of this gene is regulated by the tumor suppressor P53 and has been shown to be involved in P53-mediated apoptosis. Multiple alternatively spliced transcript variants, which encode different isoforms, have been reported for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (alpha) has an alternate splice site in the 3' coding region which causes a frame-shift, compared to variant 1. The resulting isoform (alpha, also known as psi) has a shorter and different C terminus, compared to isoform 1.
-
NCBI Accession
- NM_138761, NP_620116
Target
-