Human BIN1 cDNA Clone in Mammalian Expression Vector
This is a Bridging Integrator 1 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2400 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(2 references)
Catalog No. ABIN3388450
Supplier Product No.: sc310232
$820.71
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human BIN1 cDNA Clone in Mammalian Expression Vector (ABIN3388450)
Gene
BIN1
(Bridging Integrator 1 (BIN1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc310232
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human BIN1 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2400 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Tau phosphorylation regulates the interaction between BIN1's SH3 domain and Tau's proline-rich domain." in: Acta neuropathologica communications, Vol. 3, pp. 58, (2015) (PubMed).
: "Bridging integrator 1 (BIN1) protein expression increases in the Alzheimer's disease brain and correlates with neurofibrillary tangle pathology." in: Journal of Alzheimer's disease : JAD, Vol. 42, Issue 4, pp. 1221-7, (2014) (PubMed).
-
: "Tau phosphorylation regulates the interaction between BIN1's SH3 domain and Tau's proline-rich domain." in: Acta neuropathologica communications, Vol. 3, pp. 58, (2015) (PubMed).
-
- BIN1 (Bridging Integrator 1 (BIN1))
-
Alternative Name
- BIN1
-
Background
- This gene encodes several isoforms of a nucleocytoplasmic adaptor protein, one of which was initially identified as a MYC-interacting protein with features of a tumor suppressor. Isoforms that are expressed in the central nervous system may be involved in synaptic vesicle endocytosis and may interact with dynamin, synaptojanin, endophilin, and clathrin. Isoforms that are expressed in muscle and ubiquitously expressed isoforms localize to the cytoplasm and nucleus and activate a caspase-independent apoptotic process. Studies in mouse suggest that this gene plays an important role in cardiac muscle development. Alternate splicing of the gene results in several transcript variants encoding different isoforms. Aberrant splice variants expressed in tumor cell lines have also been described. [provided by RefSeq, Mar 2016].Transcript Variant: This variant (1) encodes the longest isoform, which is cytoplasmic. Isoform 1, also called IIa and S11R3-a, binds dynamin, synaptojanin, and clathrin. This isoform is expressed exclusively in the brain and is concentrated in nerve terminals.
-
NCBI Accession
- NM_139343, NP_647593
Target
-
You are here:
