Human CEBPA cDNA Clone in Mammalian Expression Vector
This is a CCAAT/enhancer Binding Protein (C/EBP), alpha plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1200 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(4 references)
Catalog No. ABIN3388913
Supplier Product No.: sc303472
$452.43
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human CEBPA cDNA Clone in Mammalian Expression Vector (ABIN3388913)
Gene
CEBPA
(CCAAT/enhancer Binding Protein (C/EBP), alpha (CEBPA))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc303472
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human CEBPA is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1200 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Roles for Transcription Factors Sp1, NF-κB, IRF3, and IRF7 in Expression of the Human IFNL4 Gene." in: Viral immunology, Vol. 29, Issue 1, pp. 49-63, (2016) (PubMed).
: "Role of transcription factor CCAAT/enhancer-binding protein alpha in human fetal liver cell types in vitro." in: Hepatology research : the official journal of the Japan Society of Hepatology, Vol. 45, Issue 8, pp. 919-32, (2015) (PubMed).
: "The CCAAT/enhancer-binding protein beta-2 isoform (CEBPβ-2) upregulates galectin-7 expression in human breast cancer cells." in: PLoS ONE, Vol. 9, Issue 5, pp. e95087, (2014) (PubMed).
: "Direct reprogramming of human fibroblasts to hepatocyte-like cells by synthetic modified mRNAs." in: PLoS ONE, Vol. 9, Issue 6, pp. e100134, (2014) (PubMed).
-
-
- CEBPA (CCAAT/enhancer Binding Protein (C/EBP), alpha (CEBPA))
-
Alternative Name
- CEBPA
-
Background
- This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain and recognizes the CCAAT motif in the promoters of target genes. The encoded protein functions in homodimers and also heterodimers with CCAAT/enhancer-binding proteins beta and gamma. Activity of this protein can modulate the expression of genes involved in cell cycle regulation as well as in body weight homeostasis. Mutation of this gene is associated with acute myeloid leukemia. The use of alternative in-frame non-AUG (GUG) and AUG start codons results in protein isoforms with different lengths. Differential translation initiation is mediated by an out-of-frame, upstream open reading frame which is located between the GUG and the first AUG start codons. [provided by RefSeq, Dec 2013].Transcript Variant: This variant (1) can initiate translation from an upstream non-AUG (GUG) site, and also from three downstream, in-frame AUG sites. The isoform (a, also known as C/EBP-42) represented in this RefSeq results from translation initiation at the first AUG start codon. Isoform a has a shorter N-terminus, compared to isoform c.
-
NCBI Accession
- NM_004364, NP_004355
Target
-
You are here:
