Human CLCF1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human CLCF1 cDNA Clone in Mammalian Expression Vector (ABIN3388994)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc122789
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human CLCF1 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1736 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Differential secretion of the mutated protein is a major component affecting phenotypic severity in CRLF1-associated disorders." in: European journal of human genetics : EJHG, Vol. 19, Issue 5, pp. 525-33, (2011) (PubMed).
-
: "Differential secretion of the mutated protein is a major component affecting phenotypic severity in CRLF1-associated disorders." in: European journal of human genetics : EJHG, Vol. 19, Issue 5, pp. 525-33, (2011) (PubMed).
-
- CLCF1 (Cardiotrophin-Like Cytokine Factor 1 (CLCF1))
-
Alternative Name
- CLCF1
-
Background
- This gene is a member of the glycoprotein (gp)130 cytokine family and encodes cardiotrophin-like cytokine factor 1 (CLCF1). CLCF1 forms a heterodimer complex with cytokine receptor-like factor 1 (CRLF1). This dimer competes with ciliary neurotrophic factor (CNTF) for binding to the ciliary neurotrophic factor receptor (CNTFR) complex, and activates the Jak-STAT signaling cascade. CLCF1 can be actively secreted from cells by forming a complex with soluble type I CRLF1 or soluble CNTFR. CLCF1 is a potent neurotrophic factor, B-cell stimulatory agent and neuroendocrine modulator of pituitary corticotroph function. Defects in CLCF1 cause cold-induced sweating syndrome 2 (CISS2). This syndrome is characterized by a profuse sweating after exposure to cold as well as congenital physical abnormalities of the head and spine. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009].Transcript Variant: This variant (1) encodes the longer isoform (1). Though this isoform has a predicted signal peptide at amino acids 1-27, experiments show it is retained within the cell.
-
NCBI Accession
- NM_013246, NP_037378
Target
-