Human COX11 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human COX11 cDNA Clone in Mammalian Expression Vector (ABIN3389088)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc326800
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human COX11 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- COX11 (COX11 Cytochrome C Oxidase Assembly (COX11))
-
Alternative Name
- COX11
-
Background
- Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be a heme A biosynthetic enzyme involved in COX formation, according to the yeast mutant studies. However, the studies in Rhodobacter sphaeroides suggest that this gene is not required for heme A biosynthesis, but required for stable formation of the Cu(B) and magnesium centers of COX. This human protein is predicted to contain a transmembrane domain localized in the mitochondrial inner membrane. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene has been found on chromosome 6. [provided by RefSeq, Jun 2009].Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region resulting in a frameshift, compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus, compared to isoform 1.
-
NCBI Accession
- NM_001162862, NP_001156334
Target
-