Human CT45A2 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human CT45A2 cDNA Clone in Mammalian Expression Vector (ABIN3389159)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc123264
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human CT45A2 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1053 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human CT45A2 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human CT45A2 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)ORF PExp Mammalian Expression Vector pCMV6-Entry Kanamycin CMV Promoter Myc-DYKDDDDK Tag Transient
![Human CT45A2 ORF Clone in Mammalian Expression Vector (GFP tag)]()
Human CT45A2 ORF Clone in Mammalian Expression Vector (GFP tag)ORF PExp Mammalian Expression Vector pCMV6-AC-GFP Ampicillin CMV Promoter GFP tag Stable
![Human CT45A2 ORF Clone in Lentiviral Vector (Myc-DYKDDDDK Tag)]()
Human CT45A2 ORF Clone in Lentiviral Vector (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
![Human CT45A2 ORF Clone in Lentiviral Vector (GFP tag)]()
Human CT45A2 ORF Clone in Lentiviral Vector (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human CT45A2 shRNA in Retroviral Vector (GFP tag)]()
Human CT45A2 shRNA in Retroviral Vector (GFP tag)shRNA RNAi Retroviral Vector pGFP-V-RS Kanamycin U6 Promoter GFP tag Transient
![Human CT45A2 ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human CT45A2 ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- CT45A2 (Cancer/testis Antigen Family 45, Member A2 (CT45A2))
-
Alternative Name
- CT45A2
-
Background
- This gene represents one of a cluster of several similar genes located on the q arm of chromosome X. The genes in this cluster encode members of the cancer/testis (CT) family of antigens, and are distinct from other CT antigens. These antigens are thought to be novel therapeutic targets for human cancers. [provided by RefSeq, Apr 2014].
-
NCBI Accession
- NM_152582, NP_689795
Target
-
