Human DAZ4 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human DAZ4 cDNA Clone in Mammalian Expression Vector (ABIN3389234)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc304763
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human DAZ4 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 3200 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- DAZ4 (Deleted In Azoospermia 4 (DAZ4))
-
Alternative Name
- DAZ4
-
Background
- This gene is a member of the DAZ gene family and is a candidate for the human Y-chromosomal azoospermia factor (AZF). Its expression is restricted to premeiotic germ cells, particularly in spermatogonia. It encodes an RNA-binding protein that is important for spermatogenesis. Four copies of this gene are found on chromosome Y within palindromic duplications, one pair of genes is part of the P2 palindrome and the second pair is part of the P1 palindrome. Each gene contains a 2.4 kb repeat including a 72-bp exon, called the DAZ repeat, the number of DAZ repeats is variable and there are several variations in the sequence of the DAZ repeat. Each copy of the gene also contains a 10.8 kb region that may be amplified, this region includes five exons that encode an RNA recognition motif (RRM) domain. This gene contains two copies of the 10.8 kb repeat. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2011].Transcript Variant: This variant (2) has multiple differences in the coding region, compared to variant 1. The resulting protein (isoform 2) is shorter and lacks one RRM domain and one DAZ repeat compared to isoform 1.
-
NCBI Accession
- NM_020420, NP_065153
Target
-