Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human DDX17 cDNA Clone in Mammalian Expression Vector

This is a DEAD (Asp-Glu-Ala-Asp) Box Polypeptide 17 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2500 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3389261
Supplier Product No.: sc316422
$663.30
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human DDX17 cDNA Clone in Mammalian Expression Vector (ABIN3389261)

Gene

DDX17 (DEAD (Asp-Glu-Ala-Asp) Box Polypeptide 17 (DDX17))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc316422

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human DDX17 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2500 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    DDX17 (DEAD (Asp-Glu-Ala-Asp) Box Polypeptide 17 (DDX17))

    Alternative Name

    DDX17

    Background

    DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and splicesosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an ATPase activated by a variety of RNA species, but not by dsDNA. This protein, and that encoded by DDX5 gene, are more closely related to each other than to any other member of the DEAD box family. This gene can encode multiple isoforms due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) start codon. [provided by RefSeq, Apr 2011].Transcript Variant: This variant (3) uses a different donor splice site (6 nt downstream) in the penultimate coding exon, but initiates translation from the same non-AUG (CUG) codon as transcript variant 1, resulting in an isoform (3) that is 2 aa longer than isoform 1. Alternate translation from an in-frame, downstream AUG yields a shorter isoform.

    NCBI Accession

    NM_001098504, NP_001091974
You are here: