Human DDX17 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human DDX17 cDNA Clone in Mammalian Expression Vector (ABIN3389261)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc316422
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human DDX17 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2500 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- DDX17 (DEAD (Asp-Glu-Ala-Asp) Box Polypeptide 17 (DDX17))
-
Alternative Name
- DDX17
-
Background
- DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and splicesosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an ATPase activated by a variety of RNA species, but not by dsDNA. This protein, and that encoded by DDX5 gene, are more closely related to each other than to any other member of the DEAD box family. This gene can encode multiple isoforms due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) start codon. [provided by RefSeq, Apr 2011].Transcript Variant: This variant (3) uses a different donor splice site (6 nt downstream) in the penultimate coding exon, but initiates translation from the same non-AUG (CUG) codon as transcript variant 1, resulting in an isoform (3) that is 2 aa longer than isoform 1. Alternate translation from an in-frame, downstream AUG yields a shorter isoform.
-
NCBI Accession
- NM_001098504, NP_001091974
Target
-