Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human DKK2 cDNA Clone in Mammalian Expression Vector

This is a Dickkopf 2 Homolog plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 950 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3389316
Supplier Product No.: sc304099
$495.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human DKK2 cDNA Clone in Mammalian Expression Vector (ABIN3389316)

Gene

DKK2 (Dickkopf 2 Homolog (DKK2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc304099

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human DKK2 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    950 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Hirata, Ueno, Nakajima, Tabatabai, Hinoda, Ishii, Dahiya: "Genistein downregulates onco-miR-1260b and inhibits Wnt-signalling in renal cancer cells." in: British journal of cancer, Vol. 108, Issue 10, pp. 2070-8, (2013) (PubMed).

    Zhu, Zhang, Gu, Di: "Epigenetic silencing of DKK2 and Wnt signal pathway components in human ovarian carcinoma." in: Carcinogenesis, Vol. 33, Issue 12, pp. 2334-43, (2012) (PubMed).

    Hirata, Hinoda, Nakajima, Kawamoto, Kikuno, Kawakami, Yamamura, Ueno, Majid, Saini, Ishii, Dahiya: "Wnt antagonist gene DKK2 is epigenetically silenced and inhibits renal cancer progression through apoptotic and cell cycle pathways." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 15, Issue 18, pp. 5678-87, (2009) (PubMed).

  • Target

    DKK2 (Dickkopf 2 Homolog (DKK2))

    Alternative Name

    DKK2

    Background

    This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. It can act as either an agonist or antagonist of Wnt/beta-catenin signaling, depending on the cellular context and the presence of the co-factor kremen 2. Activity of this protein is also modulated by binding to the Wnt co-receptor LDL-receptor related protein 6 (LRP6). [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_014421, NP_055236
You are here: