Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human EGR1 cDNA Clone in Mammalian Expression Vector

This is a Early Growth Response 1 plasmid from OriGene - 5 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1800 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3389417
Supplier Product No.: sc128132
$834.90
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human EGR1 cDNA Clone in Mammalian Expression Vector (ABIN3389417)

Gene

EGR1 (Early Growth Response 1 (EGR1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc128132

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human EGR1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1800 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Wang, Husain, Zhang, Centeno, Chen, Tong, Sebti, Malafa: "EGR-1/Bax pathway plays a role in vitamin E δ-tocotrienol-induced apoptosis in pancreatic cancer cells." in: The Journal of nutritional biochemistry, Vol. 26, Issue 8, pp. 797-807, (2015) (PubMed).

    Press, Viale-Bouroncle, Felthaus, Gosau, Morsczeck: "EGR1 supports the osteogenic differentiation of dental stem cells." in: International endodontic journal, Vol. 48, Issue 2, pp. 185-92, (2015) (PubMed).

    Grasberger, Chang, Shih, Presson, Sayuk, Newberry, Karagiannides, Pothoulakis, Mayer, Merchant: "Identification of a functional TPH1 polymorphism associated with irritable bowel syndrome bowel habit subtypes." in: The American journal of gastroenterology, Vol. 108, Issue 11, pp. 1766-74, (2013) (PubMed).

    Bouchard, Bélanger, Biron-Pain, St-Pierre: "EGR-1 activation by EGF inhibits MMP-9 expression and lymphoma growth." in: Blood, Vol. 116, Issue 5, pp. 759-66, (2010) (PubMed).

    Ye, Gradoville, Miller et al.: "Cellular immediate-early gene expression occurs kinetically upstream of Epstein-Barr virus bzlf1 and brlf1 following cross-linking of the B cell antigen receptor in the Akata Burkitt lymphoma cell ..." in: Journal of virology, Vol. 84, Issue 23, pp. 12405-18, (2010) (PubMed).

  • Target

    EGR1 (Early Growth Response 1 (EGR1))

    Alternative Name

    EGR1

    Background

    The protein encoded by this gene belongs to the EGR family of C2H2-type zinc-finger proteins. It is a nuclear protein and functions as a transcriptional regulator. The products of target genes it activates are required for differentitation and mitogenesis. Studies suggest this is a cancer suppressor gene. [provided by RefSeq, Dec 2014].

    NCBI Accession

    NM_001964, NP_001955
You are here: