Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human EMX2 cDNA Clone in Mammalian Expression Vector

This is a Empty Spiracles Homeobox 2 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 900 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3389449
Supplier Product No.: sc303433
$445.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human EMX2 cDNA Clone in Mammalian Expression Vector (ABIN3389449)

Gene

EMX2 (Empty Spiracles Homeobox 2 (EMX2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc303433

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human EMX2 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    900 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Yue, Li, Che, Zhang, Tolani, Mo, Zhang, Zheng, Yang, Cheng, Jin, Luh, Yang, Tseng, Giroux-Leprieur, Woodard, Hao, Wang, Jablons, He: "EMX2 Is a Predictive Marker for Adjuvant Chemotherapy in Lung Squamous Cell Carcinomas." in: PLoS ONE, Vol. 10, Issue 7, pp. e0132134, (2015) (PubMed).

    Okamoto, Hirata, Chen, Zhou, Mikami, Li, Yagui-Beltran, Beltran, Johansson, Coussens, Clement, Shi, Zhang, Koizumi, Shimizu, Jablons, He: "EMX2 is epigenetically silenced and suppresses growth in human lung cancer." in: Oncogene, Vol. 29, Issue 44, pp. 5969-75, (2010) (PubMed).

  • Target

    EMX2 (Empty Spiracles Homeobox 2 (EMX2))

    Alternative Name

    EMX2

    Background

    This gene encodes a homeobox-containing transcription factor that is the homolog to the 'empty spiracles' gene in Drosophila. Research on this gene in humans has focused on its expression in three tissues: dorsal telencephalon, olfactory neuroepithelium, and urogenetial system. It is expressed in the dorsal telencephalon during development in a low rostral-lateral to high caudal-medial gradient and is proposed to pattern the neocortex into defined functional areas. It is also expressed in embryonic and adult olfactory neuroepithelia where it complexes with eukaryotic translation initiation factor 4E (eIF4E) and possibly regulates mRNA transport or translation. In the developing urogenital system, it is expressed in epithelial tissues and is negatively regulated by HOXA10. Alternative splicing results in multiple transcript variants encoding distinct proteins.[provided by RefSeq, Sep 2009].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

    NCBI Accession

    NM_004098, NP_004089
You are here: