Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human ERCC1 cDNA Clone in Mammalian Expression Vector

This is a Excision Repair Cross Complementing Polypeptide-1 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1200 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3389480
Supplier Product No.: sc128251
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human ERCC1 cDNA Clone in Mammalian Expression Vector (ABIN3389480)

Gene

ERCC1 (Excision Repair Cross Complementing Polypeptide-1 (ERCC1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc128251

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human ERCC1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1200 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    ERCC1 (Excision Repair Cross Complementing Polypeptide-1 (ERCC1))

    Alternative Name

    ERCC1

    Background

    The product of this gene functions in the nucleotide excision repair pathway, and is required for the repair of DNA lesions such as those induced by UV light or formed by electrophilic compounds including cisplatin. The encoded protein forms a heterodimer with the XPF endonuclease (also known as ERCC4), and the heterodimeric endonuclease catalyzes the 5' incision in the process of excising the DNA lesion. The heterodimeric endonuclease is also involved in recombinational DNA repair and in the repair of inter-strand crosslinks. Mutations in this gene result in cerebrooculofacioskeletal syndrome, and polymorphisms that alter expression of this gene may play a role in carcinogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. The last exon of this gene overlaps with the CD3e molecule, epsilon associated protein gene on the opposite strand. [provided by RefSeq, Oct 2009].Transcript Variant: This variant (1) represents use of an alternate promoter and 5' UTR and uses a distinct splice pattern in the 3' coding region and 3' UTR, compared to variant 2. The resulting isoform (1) has a longer and distinct C-terminus, compared to isoform 2.

    NCBI Accession

    NM_202001, NP_973730
You are here: