Human ESR1 cDNA Clone in Mammalian Expression Vector
This is a Estrogen Receptor 1 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 3500 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(4 references)
Catalog No. ABIN3389492
Supplier Product No.: sc125287
$823.68
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 31 to 32 Business Days
Quick Overview for Human ESR1 cDNA Clone in Mammalian Expression Vector (ABIN3389492)
Gene
Estrogen Receptor alpha (ESR1)
(Estrogen Receptor 1 (ESR1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc125287
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ESR1 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 3500 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Oestrogens Downregulate Tissue Factor Pathway Inhibitor through Oestrogen Response Elements in the 5'-Flanking Region." in: PLoS ONE, Vol. 11, Issue 3, pp. e0152114, (2016) (PubMed).
: "The role of miR-206 in the epidermal growth factor (EGF) induced repression of estrogen receptor-alpha (ERalpha) signaling and a luminal phenotype in MCF-7 breast cancer cells." in: Molecular endocrinology (Baltimore, Md.), Vol. 23, Issue 8, pp. 1215-30, (2009) (PubMed).
: "Naloxone acts as an antagonist of estrogen receptor activity in MCF-7 cells." in: Molecular cancer therapeutics, Vol. 5, Issue 3, pp. 611-20, (2006) (PubMed).
: "Dosage-sensitive sex reversal adrenal hypoplasia congenita critical region on the X chromosome, gene 1 (DAX1) (NR0B1) and small heterodimer partner (SHP) (NR0B2) form homodimers individually, as well ..." in: Molecular endocrinology (Baltimore, Md.), Vol. 20, Issue 10, pp. 2326-42, (2006) (PubMed).
-
-
- Estrogen Receptor alpha (ESR1) (Estrogen Receptor 1 (ESR1))
-
Alternative Name
- ESR1
-
Background
- This gene encodes an estrogen receptor, a ligand-activated transcription factor composed of several domains important for hormone binding, DNA binding, and activation of transcription. The protein localizes to the nucleus where it may form a homodimer or a heterodimer with estrogen receptor 2. Estrogen and its receptors are essential for sexual development and reproductive function, but also play a role in other tissues such as bone. Estrogen receptors are also involved in pathological processes including breast cancer, endometrial cancer, and osteoporosis. Alternative promoter usage and alternative splicing result in dozens of transcript variants, but the full-length nature of many of these variants has not been determined. [provided by RefSeq, Mar 2014].Transcript Variant: This variant (1) uses the most proximal promoter, and encodes isoform 1. Variants 1-4 all encode the same isoform 1.
-
NCBI Accession
- NM_000125, NP_000116
Target
-
You are here:
