Human ETV1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human ETV1 cDNA Clone in Mammalian Expression Vector (ABIN3389499)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc327011
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ETV1 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- ETV1 (Ets Variant 1 (ETV1))
-
Alternative Name
- ETV1
-
Background
- This gene encodes a member of the ETS (E twenty-six) family of transcription factors. The ETS proteins regulate many target genes that modulate biological processes like cell growth, angiogenesis, migration, proliferation and differentiation. All ETS proteins contain an ETS DNA-binding domain that binds to DNA sequences containing the consensus 5'-CGGA[AT]-3'. The protein encoded by this gene contains a conserved short acidic transactivation domain (TAD) in the N-terminal region, in addition to the ETS DNA-binding domain in the C-terminal region. This gene is involved in chromosomal translocations, which result in multiple fusion proteins including EWS-ETV1 in Erwing sarcoma and at least 10 ETV1 partners (see PMID: 19657377, Table 1) in prostate cancer. In addition to chromosomal rearrangement, this gene is overexpressed in prostate cancer, melanoma and gastrointestinal stromal tumor. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011].Transcript Variant: This variant (4) represents use of an alternate promoter and 5' UTR, and lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. The resulting isoform (c) lacks an internal segment near the N-terminus, compared to isoform a. Both variants 3 and 4 encode the same isoform. This isoform contains a truncated TAD.
-
NCBI Accession
- NM_001163149, NP_001156621
Target
-