Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human FGF8 cDNA Clone in Mammalian Expression Vector

This is a Fibroblast Growth Factor 8 (Androgen-Induced) plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 930 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3389667
Supplier Product No.: sc305580
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human FGF8 cDNA Clone in Mammalian Expression Vector (ABIN3389667)

Gene

FGF8 (Fibroblast Growth Factor 8 (Androgen-Induced) (FGF8))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc305580

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human FGF8 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    930 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Luo, Yang, Ying, Chaudhry, Wang, Shimada, May, Adams, Mock, Triche, He, Wu: "Retinoid-suppressed phosphorylation of RARalpha mediates the differentiation pathway of osteosarcoma cells." in: Oncogene, Vol. 29, Issue 19, pp. 2772-83, (2010) (PubMed).

  • Target

    FGF8 (Fibroblast Growth Factor 8 (Androgen-Induced) (FGF8))

    Alternative Name

    FGF8

    Background

    The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is known to be a factor that supports androgen and anchorage independent growth of mammary tumor cells. Overexpression of this gene has been shown to increase tumor growth and angiogensis. The adult expression of this gene is restricted to testes and ovaries. Temporal and spatial pattern of this gene expression suggests its function as an embryonic epithelial factor. Studies of the mouse and chick homologs revealed roles in midbrain and limb development, organogenesis, embryo gastrulation and left-right axis determination. The alternative splicing of this gene results in four transcript variants. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (F) encodes the longest isoform (F).

    NCBI Accession

    NM_033163, NP_149353
You are here: