Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human FOXM1 cDNA Clone in Mammalian Expression Vector

This is a Forkhead Box M1 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 3500 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3389727
Supplier Product No.: sc308090
$1,089.99
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human FOXM1 cDNA Clone in Mammalian Expression Vector (ABIN3389727)

Gene

FOXM1 (Forkhead Box M1 (FOXM1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc308090

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human FOXM1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3500 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Sanabria-Figueroa, Donnelly, Foy, Buss, Castellino, Paplomata, Taliaferro-Smith, Kaumaya, Nahta et al.: "Insulin-like growth factor-1 receptor signaling increases the invasive potential of human epidermal growth factor receptor 2-overexpressing breast cancer cells via Src-focal adhesion kinase and ..." in: Molecular pharmacology, Vol. 87, Issue 2, pp. 150-61, (2014) (PubMed).

    Behren, Mühlen, Acuna Sanhueza, Schwager, Plinkert, Huber, Abdollahi, Simon: "Phenotype-assisted transcriptome analysis identifies FOXM1 downstream from Ras-MKK3-p38 to regulate in vitro cellular invasion." in: Oncogene, Vol. 29, Issue 10, pp. 1519-30, (2010) (PubMed).

    Calvisi, Pinna, Ladu, Pellegrino, Simile, Frau, De Miglio, Tomasi, Sanna, Muroni, Feo, Pascale: "Forkhead box M1B is a determinant of rat susceptibility to hepatocarcinogenesis and sustains ERK activity in human HCC." in: Gut, Vol. 58, Issue 5, pp. 679-87, (2009) (PubMed).

    Wang, Banerjee, Kong, Li, Sarkar: "Down-regulation of Forkhead Box M1 transcription factor leads to the inhibition of invasion and angiogenesis of pancreatic cancer cells." in: Cancer research, Vol. 67, Issue 17, pp. 8293-300, (2007) (PubMed).

  • Target

    FOXM1 (Forkhead Box M1 (FOXM1))

    Alternative Name

    FOXM1

    Background

    The protein encoded by this gene is a transcriptional activator involved in cell proliferation. The encoded protein is phosphorylated in M phase and regulates the expression of several cell cycle genes, such as cyclin B1 and cyclin D1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011].Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).

    NCBI Accession

    NM_202002, NP_973731
You are here: