Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human GCK cDNA Clone in Mammalian Expression Vector

This is a Glucokinase (Hexokinase 4) plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2300 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3389819
Supplier Product No.: sc305649
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human GCK cDNA Clone in Mammalian Expression Vector (ABIN3389819)

Gene

GCK (Glucokinase (Hexokinase 4) (GCK))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc305649

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human GCK is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2300 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Jin, Guo, Li, Lei, Li, Mao, Wang, Zhou, Zhang, Hu, Zhang, Niu, Irwin, Tan: "Role of glucokinase in the subcellular localization of glucokinase regulatory protein." in: International journal of molecular sciences, Vol. 16, Issue 4, pp. 7377-93, (2015) (PubMed).

  • Target

    GCK (Glucokinase (Hexokinase 4) (GCK))

    Alternative Name

    GCK

    Background

    Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. Alternative splicing of this gene results in three tissue-specific forms of glucokinase, one found in pancreatic islet beta cells and two found in liver. The protein localizes to the outer membrane of mitochondria. In contrast to other forms of hexokinase, this enzyme is not inhibited by its product glucose-6-phosphate but remains active while glucose is abundant. Mutations in this gene have been associated with non-insulin dependent diabetes mellitus (NIDDM), maturity onset diabetes of the young, type 2 (MODY2) and persistent hyperinsulinemic hypoglycemia of infancy (PHHI). [provided by RefSeq, Apr 2009].Transcript Variant: This variant (2) encodes the major isoform expressed in liver. Its first exon is specific to the liver transcripts, variants 2 and 3, but it lacks a second liver-specific exon found in variant 3. Isoform 2 has a distinct N-terminus, the remainder of the protein is identical to isoforms 1 and 3.

    NCBI Accession

    NM_033507, NP_277042
You are here: