Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human GJB2 cDNA Clone in Mammalian Expression Vector

This is a Gap Junction Protein, beta 2, 26kDa plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2263 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3389866
Supplier Product No.: sc122666
$330.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human GJB2 cDNA Clone in Mammalian Expression Vector (ABIN3389866)

Gene

GJB2 (Gap Junction Protein, beta 2, 26kDa (GJB2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc122666

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human GJB2 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2263 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Tong, Lopez, Ramachandran, Ayad, Liu, Lopez-Rodriguez, Harris, Contreras: "Glutathione release through connexin hemichannels: Implications for chemical modification of pores permeable to large molecules." in: The Journal of general physiology, Vol. 146, Issue 3, pp. 245-54, (2015) (PubMed).

    Lopez, Gonzalez, Liu, Harris, Contreras: "Insights on the mechanisms of Ca(2+) regulation of connexin26 hemichannels revealed by human pathogenic mutations (D50N/Y)." in: The Journal of general physiology, Vol. 142, Issue 1, pp. 23-35, (2013) (PubMed).

  • Target

    GJB2 (Gap Junction Protein, beta 2, 26kDa (GJB2))

    Alternative Name

    GJB2

    Background

    This gene encodes a member of the gap junction protein family. The gap junctions were first characterized by electron microscopy as regionally specialized structures on plasma membranes of contacting adherent cells. These structures were shown to consist of cell-to-cell channels that facilitate the transfer of ions and small molecules between cells. The gap junction proteins, also known as connexins, purified from fractions of enriched gap junctions from different tissues differ. According to sequence similarities at the nucleotide and amino acid levels, the gap junction proteins are divided into two categories, alpha and beta. Mutations in this gene are responsible for as much as 50 % of pre-lingual, recessive deafness. [provided by RefSeq, Oct 2008].

    NCBI Accession

    NM_004004, NP_003995
You are here: