Human GPR112 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human GPR112 cDNA Clone in Mammalian Expression Vector (ABIN3389929)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc306666
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human GPR112 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 9200 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human GPR112 ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human GPR112 ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
![Human GPR112 shRNA in Lentiviral Vector (GFP tag)]()
Human GPR112 shRNA in Lentiviral Vector (GFP tag)shRNA RNAi Lentiviral Vector pGFP-C-shLenti Chloramphenicol U6 Promoter GFP tag Transient
![Human GPR112 shRNA in Retroviral Vector (GFP tag)]()
Human GPR112 shRNA in Retroviral Vector (GFP tag)shRNA RNAi Retroviral Vector pGFP-V-RS Kanamycin U6 Promoter GFP tag Transient
![Mouse GPR112 shRNA in Retroviral Vector (RFP tag)]()
Mouse GPR112 shRNA in Retroviral Vector (RFP tag)shRNA RNAi Retroviral Vector pRFP-C-RS Chloramphenicol U6 Promoter RFP tag Transient
![Mouse GPR112 shRNA in Retroviral Vector (GFP tag)]()
Mouse GPR112 shRNA in Retroviral Vector (GFP tag)shRNA RNAi Retroviral Vector pGFP-V-RS Kanamycin U6 Promoter GFP tag Transient
![Human GPR112 shRNA in Retroviral Vector]()
Human GPR112 shRNA in Retroviral VectorshRNA RNAi Retroviral Vector pRS Ampicillin U6 Promoter unconjugated Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- GPR112 (G Protein-Coupled Receptor 112 (GPR112))
-
Alternative Name
- GPR112
-
Background
- This gene encodes a G-protein coupled receptor belonging to a large family of diverse integral membrane proteins that participate in various physiological functions. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The ligand for this family member is unknown, and it is therefore an orphan receptor. This receptor is known to be expressed in normal enterochromaffin cells and in gastrointestinal neuroendocrine carcinoma cells, and it is therefore considered to be a novel biomarker or target for immunotherapy. [provided by RefSeq, May 2010].
-
NCBI Accession
- NM_153834, NP_722576
Target
-
