Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human GRIA2 cDNA Clone in Mammalian Expression Vector

This is a Glutamate Receptor, Ionotropic, AMPA 2 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 3500 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3389992
Supplier Product No.: sc316073
$1,201.86
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human GRIA2 cDNA Clone in Mammalian Expression Vector (ABIN3389992)

Gene

GRIA2 (Glutamate Receptor, Ionotropic, AMPA 2 (GRIA2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc316073

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human GRIA2 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3500 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    GRIA2 (Glutamate Receptor, Ionotropic, AMPA 2 (GRIA2))

    Alternative Name

    GRIA2

    Background

    Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to a family of glutamate receptors that are sensitive to alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA), and function as ligand-activated cation channels. These channels are assembled from 4 related subunits, GRIA1-4. The subunit encoded by this gene (GRIA2) is subject to RNA editing (CAG->CGG, Q->R) within the second transmembrane domain, which is thought to render the channel impermeable to Ca(2+). Human and animal studies suggest that pre-mRNA editing is essential for brain function, and defective GRIA2 RNA editing at the Q/R site may be relevant to amyotrophic lateral sclerosis (ALS) etiology. Alternative splicing, resulting in transcript variants encoding different isoforms, (including the flip and flop isoforms that vary in their signal transduction properties), has been noted for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2) uses an alternate coding exon compared to transcript variant 1, and encodes an isoform (2, also known as flop isoform) that is the same length, but with a few amino acid differences from isoform 1. RNA editing (CAG->CGG) changes aa Gln607Arg.

    NCBI Accession

    NM_001083619, NP_001077088
You are here: