Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human HAND1 cDNA Clone in Mammalian Expression Vector

This is a Heart and Neural Crest Derivatives Expressed 1 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1733 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3390034
Supplier Product No.: sc122690
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human HAND1 cDNA Clone in Mammalian Expression Vector (ABIN3390034)

Gene

HAND1 (Heart and Neural Crest Derivatives Expressed 1 (HAND1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc122690

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human HAND1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1733 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Kobayashi, Yoshida, Tarui, Hirata, Nagai, Kasahara, Naruse, Ito, Sano, Oh et al.: "Directed differentiation of patient-specific induced pluripotent stem cells identifies the transcriptional repression and epigenetic modification of NKX2-5, HAND1, and NOTCH1 in hypoplastic left ..." in: PLoS ONE, Vol. 9, Issue 7, pp. e102796, (2014) (PubMed).

    Friese, Altshuler, Zhang, Miramontes-Gonzalez, Hightower, Jirout, Salem, Gayen, Mahapatra, Biswas, Cale, Vaingankar, Kim, Courel, Taupenot, Ziegler, Schork, Pravenec, Mahata, Schmid-Schönbein, OConnor: "MicroRNA-22 and promoter motif polymorphisms at the Chga locus in genetic hypertension: functional and therapeutic implications for gene expression and the pathogenesis of hypertension." in: Human molecular genetics, Vol. 22, Issue 18, pp. 3624-40, (2013) (PubMed).

    Reichman, Kalathur, Lambard, Aït-Ali, Yang, Lardenois, Ripp, Poch, Zack, Sahel, Léveillard: "The homeobox gene CHX10/VSX2 regulates RdCVF promoter activity in the inner retina." in: Human molecular genetics, Vol. 19, Issue 2, pp. 250-61, (2009) (PubMed).

  • Target

    HAND1 (Heart and Neural Crest Derivatives Expressed 1 (HAND1))

    Alternative Name

    HAND1

    Background

    The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, it has been suggested that this transcription factor may be required for early trophoblast differentiation. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_004821, NP_004812
You are here: