Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human HNF4A cDNA Clone in Mammalian Expression Vector

This is a Hepatocyte Nuclear Factor 4, alpha plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1300 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3390112
Supplier Product No.: sc302485
$679.14
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human HNF4A cDNA Clone in Mammalian Expression Vector (ABIN3390112)

Gene

HNF4A (Hepatocyte Nuclear Factor 4, alpha (HNF4A))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc302485

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human HNF4A is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1300 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Ogasawara, Terada, Asaka, Katsura, Inui: "Hepatocyte nuclear factor-4{alpha} regulates the human organic anion transporter 1 gene in the kidney." in: American journal of physiology. Renal physiology, Vol. 292, Issue 6, pp. F1819-26, (2007) (PubMed).

  • Target

    HNF4A (Hepatocyte Nuclear Factor 4, alpha (HNF4A))

    Alternative Name

    HNF4A

    Background

    The protein encoded by this gene is a nuclear transcription factor which binds DNA as a homodimer. The encoded protein controls the expression of several genes, including hepatocyte nuclear factor 1 alpha, a transcription factor which regulates the expression of several hepatic genes. This gene may play a role in development of the liver, kidney, and intestines. Mutations in this gene have been associated with monogenic autosomal dominant non-insulin-dependent diabetes mellitus type I. Alternative splicing of this gene results in multiple transcript variants encoding several different isoforms. [provided by RefSeq, Apr 2012].Transcript Variant: This variant (4) contains an alternate 5' terminal exon (resulting in translation initiation from an alternate upstream start codon) and uses an alternate in-frame donor splice site in the 3' coding region compared to variant 2. The resulting shorter isoform (HNF4alpha7) has a distinct N-terminus and lacks a 10 aa protein segment in the C-terminal region compared to isoform HNF4alpha2.

    NCBI Accession

    NM_001030003, NP_001025174
You are here: