Human HNRNPL cDNA Clone in Mammalian Expression Vector
Quick Overview for Human HNRNPL cDNA Clone in Mammalian Expression Vector (ABIN3390121)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc314118
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human HNRNPL is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2200 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Separate cis-trans pathways post-transcriptionally regulate murine CD154 (CD40 ligand) expression: a novel function for CA repeats in the 3'-untranslated region." in: The Journal of biological chemistry, Vol. 283, Issue 37, pp. 25606-16, (2008) (PubMed).
-
: "Separate cis-trans pathways post-transcriptionally regulate murine CD154 (CD40 ligand) expression: a novel function for CA repeats in the 3'-untranslated region." in: The Journal of biological chemistry, Vol. 283, Issue 37, pp. 25606-16, (2008) (PubMed).
-
- HNRNPL (Heterogeneous Nuclear Ribonucleoprotein L (HNRNPL))
-
Alternative Name
- HNRNPL
-
Background
- Heterogeneous nuclear RNAs (hnRNAs) which include mRNA precursors and mature mRNAs are associated with specific proteins to form heterogenous ribonucleoprotein (hnRNP) complexes. Heterogeneous nuclear ribonucleoprotein L is among the proteins that are stably associated with hnRNP complexes and along with other hnRNP proteins is likely to play a major role in the formation, packaging, processing, and function of mRNA. Heterogeneous nuclear ribonucleoprotein L is present in the nucleoplasm as part of the HNRP complex. HNRP proteins have also been identified outside of the nucleoplasm. Exchange of hnRNP for mRNA-binding proteins accompanies transport of mRNA from the nucleus to the cytoplasm. Since HNRP proteins have been shown to shuttle between the nucleus and the cytoplasm, it is possible that they also have cytoplasmic functions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).
-
NCBI Accession
- NM_001533, NP_001524
Target
-