Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human HSPA5 cDNA Clone in Mammalian Expression Vector

This is a Heat Shock 70kDa Protein 5 (Glucose-Regulated Protein, 78kDa) plasmid from OriGene - 5 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2500 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3390160
Supplier Product No.: sc108086
$603.90
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human HSPA5 cDNA Clone in Mammalian Expression Vector (ABIN3390160)

Gene

GRP78 (HSPA5) (Heat Shock 70kDa Protein 5 (Glucose-Regulated Protein, 78kDa) (HSPA5))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc108086

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human HSPA5 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2500 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Pybus, Dean, West, Smith, Daramola, Field, Wilkinson, James: "Model-directed engineering of "difficult-to-express" monoclonal antibody production by Chinese hamster ovary cells." in: Biotechnology and bioengineering, Vol. 111, Issue 2, pp. 372-85, (2014) (PubMed).

    Biswas, Friese, Gayen, Bandyopadhyay, Mahata, OConnor: "Discovery of a novel target for the dysglycemic chromogranin A fragment pancreastatin: interaction with the chaperone GRP78 to influence metabolism." in: PLoS ONE, Vol. 9, Issue 1, pp. e84132, (2014) (PubMed).

    Li, Zoubeidi, Beraldi, Gleave: "GRP78 regulates clusterin stability, retrotranslocation and mitochondrial localization under ER stress in prostate cancer." in: Oncogene, Vol. 32, Issue 15, pp. 1933-42, (2013) (PubMed).

    Yang, Fu, Hsiao, Sobue, Adachi, Huang, Hsuuw, Wei, Chang, Huang, Kang: "Androgen receptor inclusions acquire GRP78/BiP to ameliorate androgen-induced protein misfolding stress in embryonic stem cells." in: Cell death & disease, Vol. 4, pp. e607, (2013) (PubMed).

    Cook, Shajahan, Wärri, Jin, Hilakivi-Clarke, Clarke: "Glucose-regulated protein 78 controls cross-talk between apoptosis and autophagy to determine antiestrogen responsiveness." in: Cancer research, Vol. 72, Issue 13, pp. 3337-49, (2012) (PubMed).

  • Target

    GRP78 (HSPA5) (Heat Shock 70kDa Protein 5 (Glucose-Regulated Protein, 78kDa) (HSPA5))

    Alternative Name

    HSPA5

    Background

    The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. It is localized in the lumen of the endoplasmic reticulum (ER), and is involved in the folding and assembly of proteins in the ER. As this protein interacts with many ER proteins, it may play a key role in monitoring protein transport through the cell.[provided by RefSeq, Sep 2010].

    NCBI Accession

    NM_005347, NP_005338
You are here: